[ Program Manual | User's Guide | Data Files | Databases ]
FindPatterns identifies sequences that contain short patterns like GAATTC or YRYRYRYR. You can define the patterns ambiguously and allow mismatches. You can provide the patterns in a file or simply type them in from the terminal.
FindPatterns locates short sequence patterns. If you are trying to find a pattern in a sequence or if you know of a sequence that you think occurs somewhere within a larger one, you can find your place with FindPatterns. FindPatterns can look through large data sets for any short sequence patterns you specify. FindPatterns can recognize patterns with some symbols mismatched but not with gaps. It supports the IUPAC-IUB nucleotide ambiguity codes (see Appendix III) for searching through nucleotide sequences.
FindPatterns searches both strands of a nucleotide sequence if the patterns you specify are not identical on both strands. If your sequence is a protein, FindPatterns searches for a simple symbol match between your pattern and the protein sequence.
FindPatterns names each sequence on the screen as it is searched. The output file shows only sequences where a pattern was found unless you use -SHOw. Five residues from the original sequence are shown on either side of each "find." The word /Rev occurs if the reverse of the pattern is found. If you run FindPatterns with -NAMes, the output file is written as a list file, which you can use as input to other Wisconsin Package(TM) programs that support indirect file specifications.
You can specify patterns from a prompt or from a pattern file as described in the PATTERN FILE topic below.
When FindPatterns finishes searching for your patterns, it returns to the first prompt in the program, FINDPATTERNS in what sequence(s) ? If you simply press <Return> at the prompt, FindPatterns stops.
FindPatterns writes all of its results in the same output file. FindPatterns prints a short summary on your screen and in the output file when the search is completed.
Here is a session using FindPatterns to determine if there are any EcoRI, BamHI, or promoter sites in the human immunoglobulin sequences of the GenBank database (The program Fetch was used first to make a copy of the file pattern.dat):
% findpatterns
FINDPATTERNS in what sequence(s) ? GenBank:Humig*
Search patterns read from "pattern.dat"
What should I call the output file (* findpatterns.find *) ?
HUMIG10H len: 408
HUMIG10L len: 387
HUMIG12H len: 417
//////////////////////////
HUMIGVK1 len: 324
HUMIGVKF len: 330
HUMIGVLFA len: 333
FINDPATTERNS in what sequence(s) ?
Total finds: 682
Total length: 723,342
Total sequences: 1,587
CPU time: 7.25
Output file: /usr/users/burgess/search/findpatterns.find
%
Here is some of the output file:
! FINDPATTERNS on genbank:humig* allowing 0 mismatches
! Using patterns from: pattern.dat October 8, 1998 09:37 ..
HUMIG10H ck: 1075 len: 408 ! L38425 Homo sapiens Ig rearra
BamHI GGATCC
170: GGGCT GGATCC GCCAG
HUMIG1L ck: 7509 len: 318 ! L38432 Homo sapiens Ig rearra
BamHI GGATCC
167: CTCAG GGATCC CTGAG
HUMIG9H ck: 8709 len: 426 ! L38435 Homo sapiens Ig rearra
BamHI GGATCC
17: CTGGA GGATCC TTTTC
HUMIGAMKB ck: 9203 len: 406 ! L28050 Human Ig rearranged al
BamHI GGATCC
144: GAGCT GGATCC GTCAG
//////////////////////////////////////////////////////////////////////////
HUMIGHZBV ck: 4060 len: 234 ! L23278 Human rearranged IgH chain
BamHI GGATCC
229: CCAAG GGATCC
HUMIGKVAC ck: 9098 len: 1,331 ! M23090 Human germline IgK chain
Promotor TAATA(N){20,30}ATG
TAATAN{24}ATG
1,177: CAGTA TAATAACTGGCCTCCCACAGTGATTCAACATG AAACA
HUMIGL1A ck: 6825 len: 4,523 ! M77640 Homo sapiens L1 cell
BamHI GGATCC
1,129: CAACG GGATCC CTGTG
3,833: CCTTG GGATCC AGGCC
3,905: GCCTC GGATCC CCTTC
HUMIGLVAV ck: 7923 len: 336 ! L33443 Homo sapiens (clone Lc4)
Promotor /Rev CAT(N){20,30}TATTA
CATN{21}TATTA
60: GTCAC CATCACTTGTCGGGCGAGTCAGAGTATTA GCAGC
HUMIGHZBV ck: 4060 len: 234 ! L23278 Human rearranged IgH chain
BamHI GGATCC
229: CCAAG GGATCC
HUMIGKVAC ck: 9098 len: 1,331 ! M23090 Human germline IgK chain
Promotor TAATA(N){20,30}ATG
TAATAN{24}ATG
1,177: CAGTA TAATAACTGGCCTCCCACAGTGATTCAACATG AAACA
HUMIGL1A ck: 6825 len: 4,523 ! M77640 Homo sapiens L1 cell
BamHI GGATCC
1,129: CAACG GGATCC CTGTG
3,833: CCTTG GGATCC AGGCC
3,905: GCCTC GGATCC CCTTC
HUMIGLVAV ck: 7923 len: 336 ! L33443 Homo sapiens (clone Lc4)
Promotor /Rev CAT(N){20,30}TATTA
CATN{21}TATTA
60: GTCAC CATCACTTGTCGGGCGAGTCAGAGTATTA GCAGC
HUMIGLYM1 ck: 9847 len: 881 ! D01059 Human immunoglobulin
BamHI GGATCC
287: TCTCT GGATCC AAAGA
787: CTGCA GGATCC CAGGG
EcoRI GAATTC
2: G GAATTC CGGGT
HUMIGVK1 ck: 8546 len: 324 ! D38039 Human mRNA for immunoglobul
EcoRI GAATTC
208: GGACA GAATTC ACTCT
Databases searched:
GenBank, Release 108.0, Released on 16Aug1998, Formatted on 17Aug1998
Total finds: 695
Total length: 738,064
Total sequences: 1,596
CPU time: 07.25
If the pattern is a complex expression, it will be written above each find along with a simplification of the ambiguous parts of the pattern so that you can see what was actually found. In the above example, the Promoter pattern CAT(N){20,30}TATTA is the pattern being searched, and in the first case shown, CATN{23}TATTA is the pattern actually found. Five residues from the original sequence are shown on either side of the find. In the example above, 119 is the coordinate of the first C in CATGCCAA ... not of the G in the flanking residues GATCA.
FindPatterns takes single or multiple sequences as input. You can specify multiple sequences in a number of ways: by using a list file, for example @project.list; by using an MSF or RSF file, for example project.msf{*}; or by using a sequence specification with an asterisk (*) wildcard, for example GenEMBL:*. The function of FindPatterns depends on whether your input sequence(s) are protein or nucleotide. Programs determine the type of a sequence by the presence of either Type: N or Type: P on the last line of the text heading just above the sequence. If your sequence(s) are not the correct type, see Appendix VI for information on how to change or set the type of a sequence.
The Wisconsin Package mapping programs Map, MapPlot and MapSort can be used to mark finds in the context of a DNA restriction map. Motifs looks for sequence motifs by searching through proteins for the patterns defined in the PROSITE Dictionary of Protein Sites and Patterns. These programs all use the same search algorithm and input data file format as FindPatterns.
Patterns typed in from the terminal may not be longer than 132 characters. Patterns from a data file may not be longer than 350 characters.
FindPatterns can search for a maximum of 10,000 patterns in a nucleotide search. If your pattern.dat file contains more than 10,000 patterns, only the first 10,000 are used.
The restrictions specified using -MINCuts and -MAXCuts refer to the number of times a pattern if found in a sequence and must be fulfilled on a single strand of a nucleotide sequence for the find to be reported. For instance, if you use -MINCuts=2 and -PATterns=CCCC with the sequence CCCCGGGG, no finds will be reported, because although there are two finds there is only one instance of the pattern on each strand.
The database programs LookUp, Names, StringSearch, FindPatterns, FastA, TFastA, FastX, TFastX, SSearch, and WordSearch can be used for list refinement if you are looking for sequences with something in common. For instance, you could identify human globin nucleotide sequences with LookUp. The output list from LookUp could then be refined further with FindPatterns to show only those human globin sequences containing EcoRI sites. If you run FindPatterns with -NAMes, you could then do a FastA sequence search on the FindPatterns list file output to see if a sequence you have is similar to any of these EcoRI-containing human globin sequences.
You can add two lists together by simply appending one of the files to the other. It is better if you use a text editor to modify the heading of the combined list so that the annotation in the list correctly reflects what you have done. Remember to delete the text heading from the second file so that it does not occur in the middle of the list.
Suppress any item in a list by typing an exclamation point (!) in front of the item. You can also put comments into a list anywhere on a line by placing an exclamation point before the comment.
FindPatterns, Map, MapSort, MapPlot, and Motifs all let you search with ambiguous expressions that match many different sequences. The expressions can include any legal GCG sequence character (see Appendix III). The expressions can also include several non-sequence characters, which are used to specify OR matching, NOT matching, begin and end constraints, and repeat counts. For instance, the expression TAATA(N){20,30}ATG means TAATA, followed by 20 to 30 of any base, followed by ATG. Following is an explanation of the syntax for pattern specification.
Parentheses () enclose one or more symbols that can be repeated some number of times. Braces {} enclose numbers that tell how many times the symbols within the preceding parentheses must be found.
Sometimes, you can leave out part of an expression. If braces appear without preceding parentheses, the numbers in the braces define the number of repeats for the immediately preceding symbol. One or both of the numbers within the braces may be missing. For instance, both the pattern GATG{2,}A and the pattern GATG{2}A mean GAT, followed by G repeated from 2 to 350,000 times, followed by A; the pattern GATG{}A means GAT, followed by G repeated from 0 to 350,000 times, followed by A; the pattern GAT(TG){,2}A means GAT, followed by TG repeated from 0 to 2 times, followed by A; the pattern GAT(TG){2,2}A means GAT, followed by TG repeated exactly 2 times, followed by A. (If the pattern in the parentheses is an OR expression (see below), it cannot be repeated more than 2,000 times.)
If you are searching nucleic acids, the ambiguity symbols defined in Appendix III let you define any combination of G, A, T, or C. If you are searching proteins, you can specify any of several symbol choices by enclosing the different choices in parentheses and separating the choices with commas. For instance, RGF(Q,A)S means RGF followed by either Q or A followed by S. The length of each choice need not be the same, and there can be up to 31 different choices within each set of parentheses. The pattern GAT(TG,T,G){1,4}A means GAT followed by any combination of TG, T, or G from 1 to 4 times followed by A. The sequence GATTGGA matches this pattern. There can be several parentheses in a pattern, but parentheses cannot be nested.
The pattern GC~CAT means GC, followed by any symbol except C, followed by AT. The pattern GC~(A,T)CC means GC, followed by any symbol except A or T, followed by CC.
The pattern <GACCAT can only be found if it occurs at the beginning of the sequence range being searched. Likewise, the pattern GACCAT> would only be found if it occurs at the end of the sequence range.
FindPatterns will not introduce gaps, but it can tolerate mismatches when it is run with -MISmatch. Mismatched finds are shown in the output in lowercase.
If you are entering patterns from the command line with the -PATterns parameter, any pattern containing a comma must be enclosed in double quotes; otherwise, the comma is assumed to separate different patterns on the command line.
The file GenMoreData:tfsites.dat contains patterns for transcription factor binding sites. You can search for the presence of these sites in one or more nucleotide sequences with -DATa=GenMoreData:tfsites.dat.
There is information on specifying sets of sequences in Chapter 2, Using Sequence Files and Databases of the User's Guide.
FindPatterns is one of the few programs in the Wisconsin Package that can take more than a few minutes to run. Large searches should probably be run in the batch queue. You can specify that this program run at a later time in the batch queue by using -BATch. Run this way, the program prompts you for all the required parameters and then automatically submits itself to the batch or at queue. For more information, see "Using the Batch Queue" in Chapter 3, Using Programs in the User's Guide. Very large comparisons may exceed the CPU limit set by some systems.
Patterns that start with complicated OR or NOT expressions take longer to search than simple expressions like GATTC.
You can put any patterns you want to search for into a file like the one below. The pattern data files for FindPatterns are modeled on the enzyme data files for the mapping programs described in Appendix VII. The pattern names should not have more than eight letters. The offset field is ignored by FindPatterns, but the field should have an integer number in it to make these files compatible with the files that are read by mapping programs.
The exact column used for each field does not matter, only the order of the fields in the line. You can give several patterns the same name, but put all of the entries for that name on adjacent lines of the file. The patterns may not be more than 350 characters long. Blank lines and lines that start with an exclamation point (!) are ignored.
If the overhang field is a period (.) instead of a number, only the top strand of a nucleic acid sequence is searched for the pattern. Any number implies that both strands are to be searched. The value of the overhang number has no significance to FindPatterns. Here is the pattern data file used in the example above:
!!PATTERNS 1.0
An example of a pattern data file for the program FINDPATTERNS.
Name Offset Pattern Overhang Documentation ..
BamHI 1 GGATCC 0 !
EcoRI 1 GAATTC 0 !
Promotor 1 TAATA(N){20,30}ATG 0 !
All parameters for this program may be added to the command line. Use -CHEck to view the summary below and to specify parameters before the program executes. In the summary below, the capitalized letters in the parameter names are the letters that you must type in order to use the parameter. Square brackets ([ and ]) enclose parameter values that are optional. For more information, see "Using Program Parameters" in Chapter 3, Using Programs in the User's Guide.
Minimal Syntax: % findpatterns [-INfile=]GenBank:Humig* -Default Prompted Parameters: -PATterns=GAATTC,RGGAY specifies patterns for which to search [-OUTfile=]findpatterns.find names the output file Local Data Files: -DATa=pattern.dat names a file with a set of patterns Optional Parameters: -MISmatch=1 allows mismatches in the search for your subsequence -NAMes writes the output as a list file -ONEstrand searches only the top strand of nucleotide sequences -CIRcular searches all sequences as if they were circular -ALL does an "overlapping-set" search in nucleotide sequences -PERFect looks only for perfect matches -APPend appends the pattern data file to the output file -SHOw shows every file searched even if there are no finds -TERminal writes output to the terminal screen instead of a file -NOMONitor suppresses the screen trace showing each file -MINSitelen=6 searches for patterns with 6 (or more) residues in pattern -MINCuts=1 limits finds to patterns found a minimum of 1 time -MAXCuts=3 limits finds to patterns found a maximum of 3 times -ONCe limits finds to patterns found a maximum of 1 time -EXCLude=n1,n2 excludes patterns found between positions n1 and n2 -SINce=6.90 limits search to sequences dated on or after June 1990 -BATch submits the program to run in the batch queue -RSF[=findpatterns.rsf] specifies an RSF output file
The files described below supply auxiliary data to this program. The program automatically reads them from a public data directory unless you either 1) have a data file with exactly the same name in your current working directory; or 2) name a file on the command line with an expression like -DATa1=myfile.dat. For more information see Chapter 4, Using Data Files in the User's Guide.
FindPatterns can read the patterns you want to find from the file pattern.dat in your working directory. If you don't have a file called pattern.dat in your directory, FindPatterns asks you to type in the patterns you want to find. If you want to use a pattern data file with a name other than pattern.dat, include -DATa=filename on the command line.
You can set the parameters listed below from the command line. For more information, see "Using Program Parameters" in Chapter 3, Using Programs in the User's Guide.
specifies the patterns to be found.
causes the program to recognize sites that are like the recognition site but with one (or more) mismatches. If you allow too many mismatches, you may get ridiculous results. The output from most mapping programs distinguishes between real sites and sites with one or more mismatches.
writes the output file as a list file suitable for input to other Wisconsin Package programs that support indirect file specification (see Chapter 2, Using Sequence Files and Databases of the User's Guide). All of the output showing the location of the patterns found is suppressed when the output is written as a list file.
searches only the top strand of nucleotide sequences.
searches past the end of the sequence into the beginning of the sequence as if the molecule were continuous. Patterns that span the origin can only be found if the search is -CIRcular.
makes an overlap set map instead of the usual subset map. If your sequence is very ambiguous (as for instance a back-translated sequence would be) and you want to see where restriction sites could be, then you should create an overlap-set map. Overlap-set and subset pattern recognition are discussed in more detail in the Program Manual entry for Window.
sets the program to look for a perfect alphabetic match between the site and the sequence. Ambiguity codes are normally expanded so that the site RXY would find sequences like ACT or GAC. With this parameter the ambiguity codes are not expanded so the site RXY would only match the sequence RXY. This parameter is not the same as -MISmatch=0.
appends the input enzyme data file to your output file.
Normally, FindPatterns shows that a file was searched only if there were one or more finds in sequence. With -SHOw, FindPatterns shows every file searched whether or not a pattern was actually found in it. (-SHOw is equivalent to setting -MINCuts=0.)
writes output on the terminal screen and suppresses the output file query. If you use FindPatterns often in this mode, you should assign a logical symbol that runs FindPatterns with terminal output as the default. Answering the output file query with term has the same effect on FindPatterns.
This program normally monitors its
progress on your screen.
However, when you use -Default
to suppress all program interaction,
you also suppress the monitor.
You can turn it
back on with
this parameter. If you
are running the program in
batch, the monitor will appear
in the log file.
The descriptions of the exclusionary
parameters below were written for
the Wisconsin Package
mapping programs. A find
in these applications is referred
to as a cut while
a pattern is referred
to as a restriction enzyme
recognition site.
selects only patterns with the specified number or more bases in the recognition site. You can display the sites from any pattern in the enzyme or pattern file that you take the trouble to name individually, but when you use all of the patterns, the program uses all of the patterns whose recognition sites have the specified number or more non-N, non-X bases. The -MINCuts, -MAXCuts, -ONCe, and -EXClude parameters suppress the display of patterns by the number of times the patterns are found in a sequence (abbreviated as cuts).
excludes patterns that are not found at least two times.
excludes patterns found more than two times.
excludes patterns found in your sequence more than once (equivalent to setting both mincuts and maxcuts to one).
excludes patterns found anywhere within one or more ranges of the sequence. If a pattern is found within an excluded range, then the pattern is not displayed. The ranges are defined with sets of two numbers. The numbers are separated by commas. Spaces between numbers are not allowed. The numbers must be integers that fall within the sequence beginning and ending points you have chosen. The range may be circular if the sequence being analyzed is circular. Exclusion is not done if there are any non-numeric characters in the numbers or numbers out of range or if there is an odd number of integers following the parameter.
limits the search to sequences that have been entered into the database or modified since June 1990. As this is being written, only the EMBL, GenBank, and SWISS-PROT databases support this parameter.
submits the program to the batch queue for processing after prompting you for all required user inputs. Any information that would normally appear on the screen while the program is running is written into a log file. Whether that log file is deleted, printed, or saved to your current directory depends on how your system manager has set up the command that submits this program to the batch queue. All output files are written to your current directory, unless you direct the output to another directory when you specify the output file.
writes an RSF (rich sequence format) file containing the input sequences annotated with features generated from the results of FindPatterns. This RSF file is suitable for input to other Wisconsin Package programs that support RSF files. In particular, you can use SeqLab to view this features annotation graphically. If you don't specify a file name with this parameter, then the program creates one using findpatterns for the file basename and .rsf for the extension. For more information on RSF files, see "Using Rich Sequence Format (RSF) Files" in Chapter 2 of the User's Guide. Or, see "Rich Sequence Format (RSF) Files" in Appendix C of the SeqLab Guide.
[ Program Manual | User's Guide | Data Files | Databases ]
Documentation Comments: doc-comments@gcg.com
Technical Support: help@gcg.com
Copyright (c) 1982, 1983, 1985, 1986, 1987, 1989, 1991, 1994, 1995, 1996, 1997, 1998 Genetics Computer Group Inc., a wholly owned subsidiary of Oxford Molecular Group, Inc. All rights reserved.
Licenses and Trademarks Wisconsin Package is a trademark of Genetics Computer Group, Inc. GCG and the GCG logo are registered trademarks of Genetics Computer Group, Inc.
All other product names mentioned in this documentation may be trademarks, and if so, are trademarks or registered trademarks of their respective holders and are used in this documentation for identification purposes only.